Internal Transcribed Spacer Region DNA Research Articles

Possible new Arkansas endemic plant revealed by DNA sequence analysis, A

Cardamine angustata var. ouachitana, a wildflower in the mustard family (Brassicaceae), was described by Smith in 1982 to include a form of Cardamine found only in the Ouachita Mountains of Arkansas. This variety is morphologically very similar to typical Cardamine angustata. The major difference noted by Smith for the two varieties was the complete lack of leaf hairs (trichomes) in the new variety, whereas typical Cardamine angustata normally possesses trichomes. However, Al-Shehbaz rejected the variety ouachitana and reduced it to synonymy with the typical C. angustata. The recommendation of Al-Shehbaz has been followed and the taxon Cardamine angustata var. ouachitana is currently not accepted by most plant taxonomists. We performed a preliminary evaluation of the status of Cardamine angustata var. ouachitana by comparing ribosomal internal transcribed spacer region DNA sequences from specimens of Cardamine angustata var. ouachitana with sequences of Cardamine angustata from the main range of the species and other related species of Cardamine. Phylogenetic analyses of these data produced an unexpected result; specimens of C. angustata var. ouachitana were actually closely related to C. concatenata, rather than the expected close relationship with C. angustata. However, C. angustata var. ouachitana is morphologically distinct from C. concatenata. These results suggest that Cardamine angustata var. ouachitana is actually a new species found only in the Ouachita Mountains of Arkansas.

First Report of Powdery Mildew Caused by Podosphaera leucotricha on Callery Pear in North America.

Callery pear, often referred to as Bradford pear, is a species native to China that is planted throughout North America as an ornamental tree for its white flowers in spring, bright colored foliage in autumn, and resistance to disease. In some regions it is becoming an invasive species that is replacing native trees. In May 2009, leaves of Pyrus calleryana 'Cleveland Select' showing distortion and signs of powdery mildew were collected in Columbia (Howard County), Maryland. A survey of the surrounding area found numerous similarly diseased trees of this cultivar. Microscopic observation of the leaves revealed a fungus with an Oidium anamorph having nipple-shaped appressoria; conidiophores erect, foot cells cylindric, straight, of terminal origin, 41 to 55 × 9.5 to 12.5 μm, with the following cells present in variable numbers; conidia catenulate, broadly ellipsoid to rarely slightly ovoid, 22 to 27 × 11 to 17 μm, with fibrosin bodies. Chasmothecia were absent. On the basis of morphology and host, the fungus was identified as Podosphaera leucotricha (Ellis & Everh.) E.S. Salmon (Leotiomycetes, Erysiphales) (1). The specimen on P. calleryana was deposited in the U.S. National Fungus Collections as BPI 879141. Additional confirmation resulted from a comparison of internal transcribed spacer (ITS) region DNA sequence data (GenBank Accession No. GU122230) obtained with the custom designed primer, Podoprimer Forward (5'-3' ACTCGTTCTGCGCGGCTGAC), and the ITS4 primer. The sequence of the fungus on Callery pear was identical to available GenBank sequences of P. leucotricha. P. leucotricha is the etiological agent of a powdery mildew disease that occurs on rosaceous plants, primarily Malus and Pyrus. This fungus occurs nearly worldwide (1), and the pathology of the disease on Callery pear is similar to that of known hosts (1,4). To our knowledge, this is the first report of P. leucotricha on Pyrus calleryana in North America. P. leucotricha has been reported previously only once on Callery pear, Pyrus calleryana 'Chanticleer', in Hungary (4). Additionally, the powdery mildew fungus was heavily parasitized by Ampelomyces quisqualis Ces. sensu lato, a cosmopolitan coelomycetous mycoparasite of the Erysiphales that is well known on this species (2,3). ITS region DNA sequence data from the Ampelomyces (GenBank Accession No. GU122231) obtained with the ITS1 and ITS4 primers was identical to that of other isolates parasitic on P. leucotricha (2).

Molecular genetic variation in Emmonsia crescens and Emmonsia parva, etiologic agents of adiaspiromycosis, and their phylogenetic relationship to Blastomyces dermatitidis (Ajellomyces dermatitidis) and other systemic fungal pathogens.

Emmonsia crescens, an agent of adiaspiromycosis, Blastomyces dermatitidis, the agent of blastomycosis, and Histoplasma capsulatum, the agent of histoplasmosis, are known to form meiotic (sexual) stages in the ascomycete genus Ajellomyces (Onygenaceae, Onygenales), but no sexual stage is known for E. parva, the type species of the genus Emmonsia. To evaluate relationships among members of the putative Ajellomyces clade, large-subunit ribosomal and internal transcribed spacer region DNA sequences were determined from PCR-amplified DNA fragments. Sequences were analyzed phylogenetically to evaluate the genetic variation within the genus Emmonsia and evolutionary relationships to other taxa. E. crescens and E. parva are distinct species. E. crescens isolates are placed into two groups that correlate with their continents of origin. Considerable variation occurred among isolates previously classified as E. parva. Most isolates are placed into two closely related groups, but the remaining isolates, including some from human sources, are phylogenetically distinct and represent undescribed species. Strains of B. dermatitidis are a sister species of E. parva. Paracoccidioides brasiliensis and Histoplasma capsulatum are ancestral to most Emmonsia isolates, and P. brasiliensis, which has no known teleomorph, falls within the Ajellomyces clade.